Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4314365
End position: 4314388
Length: 24

DNA sequence
>NC_021177, from 4314365 to 4314388 (24 bp); Streptomyces fulvissimus DSM 40593 GCGTCGGCGACGGCCTCGGCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4313480-4314562	Sequence	SFUL_3855 - Valine dehydrogenase (Protein is coded in complementary strand; from 4314562 to 4313480)