Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4282651
End position: 4282674
Length: 24

DNA sequence
>NC_021177, from 4282651 to 4282674 (24 bp); Streptomyces fulvissimus DSM 40593 ACGGCGACAGCGGCGGCGATGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4280890-4282779	Sequence	SFUL_3823 - Lysyl oxidase (Protein is coded in complementary strand; from 4282779 to 4280890)