Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4260848
End position: 4260871
Length: 24

DNA sequence
>NC_021177, from 4260848 to 4260871 (24 bp); Streptomyces fulvissimus DSM 40593 CCTGCTCCTGCTCCTACTCCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4260862-4261506	Sequence	SFUL_3807 - Acetyltransferase (Protein is coded in complementary strand; from 4261506 to 4260862)