Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4255897
End position: 4255923
Length: 27

DNA sequence
>NC_021177, from 4255897 to 4255923 (27 bp); Streptomyces fulvissimus DSM 40593 GCCGTCGTGGCCGTCGTGGCCGTCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4255867-4256592	Sequence	SFUL_3802 - HhH-GPD family protein (Protein is coded in complementary strand; from 4256592 to 4255867)