Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4215340
End position: 4215363
Length: 24

DNA sequence
>NC_021177, from 4215340 to 4215363 (24 bp); Streptomyces fulvissimus DSM 40593 CCGGGGCGGGGGCGGGGGCCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4214964-4215860	Sequence	SFUL_3759 - Endonuclease/exonuclease/phosphatase (Protein is coded in complementary strand; from 4215860 to 4214964)