Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4209548
End position: 4209571
Length: 24

DNA sequence
>NC_021177, from 4209548 to 4209571 (24 bp); Streptomyces fulvissimus DSM 40593 GACGCCGCCGCCGAGGCCCACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4208451-4210136	Sequence	SFUL_3755 - Putative two-component system sensor kinase