Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4190886
End position: 4190912
Length: 27

DNA sequence
>NC_021177, from 4190886 to 4190912 (27 bp); Streptomyces fulvissimus DSM 40593 CTGGTCCCGCTGGTCCCGTTGGTCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4190418-4191155	Sequence	SFUL_3730 - Collagen triple helix repeat protein Precursor