Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 4151237
End position: 4151296
Length: 60

DNA sequence
>NC_021177, from 4151237 to 4151296 (60 bp); Streptomyces fulvissimus DSM 40593 GCCCGGACCGATCTGCGCCGGACCGATCTGCGCCGGACCGACCTGCGCCGGACCGATCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4150014-4153439	Sequence	SFUL_3674 - Putative two-component system sensor kinase/response regulator (Protein is coded in complementary strand; from 4153439 to 4150014)