Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3949675
End position: 3949710
Length: 36

DNA sequence
>NC_021177, from 3949675 to 3949710 (36 bp); Streptomyces fulvissimus DSM 40593 CGGCTCCTCGGACTCCTCCTCGGACGGCTCCTCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3949367-3950959	Sequence	SFUL_3479 - Serine/threonine protein kinase (Protein is coded in complementary strand; from 3950959 to 3949367)