Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3925632
End position: 3925658
Length: 27

DNA sequence
>NC_021177, from 3925632 to 3925658 (27 bp); Streptomyces fulvissimus DSM 40593 ACCCATCTGGCCCATCTGACCCATCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3925237-3925695	Sequence	SFUL_3456 - hypothetical protein (Protein is coded in complementary strand; from 3925695 to 3925237)