Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3913933
End position: 3913977
Length: 45

DNA sequence
>NC_021177, from 3913933 to 3913977 (45 bp); Streptomyces fulvissimus DSM 40593 CCTGACCGGCCGAGAGCTGACCTGTCGAGAGCCGACCGGCCGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3912352-3913938	Sequence	SFUL_3447 - hypothetical protein
ORF. 3913872-3915197	Sequence	SFUL_3448 - Sensor protein cutS (Protein is coded in complementary strand; from 3915197 to 3913872)