Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3859451
End position: 3859477
Length: 27

DNA sequence
>NC_021177, from 3859451 to 3859477 (27 bp); Streptomyces fulvissimus DSM 40593 GCCTCCCCGGCCTCCCCGGCCTCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3859328-3860227	Sequence	SFUL_3399 - Two-component system response regulator (Protein is coded in complementary strand; from 3860227 to 3859328)