Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3850268
End position: 3850303
Length: 36

DNA sequence
>NC_021177, from 3850268 to 3850303 (36 bp); Streptomyces fulvissimus DSM 40593 GCCGCCGGAGCGGGCGCCGGAGGGGCCGCCGGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3848784-3850352	Sequence	SFUL_3389 - DEAD/DEAH box helicase domain protein (Protein is coded in complementary strand; from 3850352 to 3848784)