Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3841874
End position: 3841909
Length: 36

DNA sequence
>NC_021177, from 3841874 to 3841909 (36 bp); Streptomyces fulvissimus DSM 40593 ACCAGCAGGAACAGCAGCAGGAAGACCGGCAGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3841586-3842812	Sequence	SFUL_3383 - Sodium/hydrogen exchanger (Protein is coded in complementary strand; from 3842812 to 3841586)