Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3820538
End position: 3820600
Length: 63

DNA sequence
>NC_021177, from 3820538 to 3820600 (63 bp); Streptomyces fulvissimus DSM 40593 GACCGGCACGACCGGCGCCCCGAACGACGCGTCCGGCGCCCCGAGCGCCACGCCCGGCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3819131-3820540	Sequence	SFUL_3358 - FMN-dependent oxidoreductase, nitrilotriacetate monooxygenase family
ORF. 3820537-3821853	Sequence	SFUL_3359 - Luciferase-like, subgroup