Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3799546
End position: 3799599
Length: 54

DNA sequence
>NC_021177, from 3799546 to 3799599 (54 bp); Streptomyces fulvissimus DSM 40593 GTGCTCGGGTCCTTCTCAGCACTCGGGCCCTTCTCAGCGCTCAGGTCCTTCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3798727-3799656	Sequence	SFUL_3341 - Endonuclease/exonuclease/phosphatase (Protein is coded in complementary strand; from 3799656 to 3798727)