Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3789056
End position: 3789079
Length: 24

DNA sequence
>NC_021177, from 3789056 to 3789079 (24 bp); Streptomyces fulvissimus DSM 40593 CGCGTCACGGCGTCACCGTGTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3789077-3790291	Sequence	SFUL_3335 - Aqualysin 1 (Protein is coded in complementary strand; from 3790291 to 3789077)