Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3721425
End position: 3721448
Length: 24

DNA sequence
>NC_021177, from 3721425 to 3721448 (24 bp); Streptomyces fulvissimus DSM 40593 GCCACCGCCACCGCCACCGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3721234-3722850	Sequence	SFUL_3276 - Spermidine synthase (Protein is coded in complementary strand; from 3722850 to 3721234)