Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3720505
End position: 3720531
Length: 27

DNA sequence
>NC_021177, from 3720505 to 3720531 (27 bp); Streptomyces fulvissimus DSM 40593 CTCGGCGGGCTCTGCGGGCTCGGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3720212-3721162	Sequence	SFUL_3275 - Carbon monoxide dehydrogenase subunit G (Protein is coded in complementary strand; from 3721162 to 3720212)