Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 370719
End position: 370763
Length: 45

DNA sequence
>NC_021177, from 370719 to 370763 (45 bp); Streptomyces fulvissimus DSM 40593 GTTCGGGGTCCGGACGGTCGGGGGCCGGGCGTTCGCGGTCCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 369386-371740	Sequence	SFUL_339 - Serine/threonine protein kinase (Protein is coded in complementary strand; from 371740 to 369386)