Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3699001
End position: 3699054
Length: 54

DNA sequence
>NC_021177, from 3699001 to 3699054 (54 bp); Streptomyces fulvissimus DSM 40593 ACCGTGCCGGTGACCGCGACCGTACCGGTGACGGAGACCGTATCGGTGACCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3698707-3699060	Sequence	SFUL_3254 - hypothetical protein
ORF... 3699047-3700123	Sequence	SFUL_3255 - Polyprenyl synthetase