Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3691046
End position: 3691081
Length: 36

DNA sequence
>NC_021177, from 3691046 to 3691081 (36 bp); Streptomyces fulvissimus DSM 40593 GTGGTGCCGGTGGTGGTGCCCGTGGTGGTCCCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3690632-3691879	Sequence	SFUL_3249 - Large tegument protein (Protein is coded in complementary strand; from 3691879 to 3690632)