Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3688822
End position: 3688848
Length: 27

DNA sequence
>NC_021177, from 3688822 to 3688848 (27 bp); Streptomyces fulvissimus DSM 40593 TCCGGTCCCTCCGGTCCCTCCGGTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3688732-3689883	Sequence	SFUL_3247 - HTTM domain protein (Protein is coded in complementary strand; from 3689883 to 3688732)