Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3670624
End position: 3670653
Length: 30

DNA sequence
>NC_021177, from 3670624 to 3670653 (30 bp); Streptomyces fulvissimus DSM 40593 GTGCCGAGCGGTGCCGAGCGGTGCCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3670094-3670732	Sequence	SFUL_3224 - NAD-dependent epimerase/dehydratase (Protein is coded in complementary strand; from 3670732 to 3670094)