Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3598013
End position: 3598036
Length: 24

DNA sequence
>NC_021177, from 3598013 to 3598036 (24 bp); Streptomyces fulvissimus DSM 40593 CTCGACCTGGACCTCGACCTCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3597999-3598469	Sequence	SFUL_3163 - Endoribonuclease L-PSP (Protein is coded in complementary strand; from 3598469 to 3597999)