Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3574626
End position: 3574679
Length: 54

DNA sequence
>NC_021177, from 3574626 to 3574679 (54 bp); Streptomyces fulvissimus DSM 40593 CCCCGCTGCCCGTCCGGACCACACTTCCCGTCCGGACCGCGCTGCCCATCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3573968-3574870	Sequence	SFUL_3144 - Type II secretion system F domain protein (Protein is coded in complementary strand; from 3574870 to 3573968)