Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3573414
End position: 3573449
Length: 36

DNA sequence
>NC_021177, from 3573414 to 3573449 (36 bp); Streptomyces fulvissimus DSM 40593 CGGGCCGCGGCCCGGGCCCCCGCCCGTGCCGCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3573204-3573632	Sequence	SFUL_3142 - TadE family protein (Protein is coded in complementary strand; from 3573632 to 3573204)