Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3557140
End position: 3557202
Length: 63

DNA sequence
>NC_021177, from 3557140 to 3557202 (63 bp); Streptomyces fulvissimus DSM 40593 CCGCCGGCGGTCCTCCTCGGCGCGGCGGCGGGCCTCCTCGGCACGCTGCCGGGCCTCCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3556241-3559540	Sequence	SFUL_3132 - Integral membrane protein with kinase activity (Protein is coded in complementary strand; from 3559540 to 3556241)