Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3508975
End position: 3508998
Length: 24

DNA sequence
>NC_021177, from 3508975 to 3508998 (24 bp); Streptomyces fulvissimus DSM 40593 CCGTTTCCGTATCCGTATCCGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3508743-3509960	Sequence	SFUL_3088 - DUF2786 domain containing protein (Protein is coded in complementary strand; from 3509960 to 3508743)