Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3506558
End position: 3506584
Length: 27

DNA sequence
>NC_021177, from 3506558 to 3506584 (27 bp); Streptomyces fulvissimus DSM 40593 CCCTCAGCGCCCTCGGCGCCCTCAGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3506580-3508706	Sequence	SFUL_3087 - hypothetical protein (Protein is coded in complementary strand; from 3508706 to 3506580)