Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3503095
End position: 3503118
Length: 24

DNA sequence
>NC_021177, from 3503095 to 3503118 (24 bp); Streptomyces fulvissimus DSM 40593 CGAGCGCCAGCGCGGGCGCGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3502149-3503606	Sequence	SFUL_3082 - Aldehyde dehydrogenase (Protein is coded in complementary strand; from 3503606 to 3502149)