Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 348680
End position: 348703
Length: 24

DNA sequence
>NC_021177, from 348680 to 348703 (24 bp); Streptomyces fulvissimus DSM 40593 GGTGACGGTGCCGGTGGCGGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 347943-348899	Sequence	SFUL_324 - DUF35 multi-domain protein (Protein is coded in complementary strand; from 348899 to 347943)