Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3473191
End position: 3473235
Length: 45

DNA sequence
>NC_021177, from 3473191 to 3473235 (45 bp); Streptomyces fulvissimus DSM 40593 GCCGGGGTCTGCGCAGCCGGGGCGTTCGCATCCGGGGTCTTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3472693-3473910	Sequence	SFUL_3054 - Secreted protein (Protein is coded in complementary strand; from 3473910 to 3472693)