Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3461769
End position: 3461792
Length: 24

DNA sequence
>NC_021177, from 3461769 to 3461792 (24 bp); Streptomyces fulvissimus DSM 40593 AGCCGCAGCCGTCGCCGCAGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3460823-3461881	Sequence	SFUL_3043 - Nicotinate-nucleotide pyrophosphorylase (Protein is coded in complementary strand; from 3461881 to 3460823)