Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3443681
End position: 3443725
Length: 45

DNA sequence
>NC_021177, from 3443681 to 3443725 (45 bp); Streptomyces fulvissimus DSM 40593 CCGTCCGTGCCCGAACCGCCCGTACCCGAACCGGCCGTGTCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3443234-3444067	Sequence	SFUL_3026 - hypothetical protein (Protein is coded in complementary strand; from 3444067 to 3443234)