Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3437226
End position: 3437285
Length: 60

DNA sequence
>NC_021177, from 3437226 to 3437285 (60 bp); Streptomyces fulvissimus DSM 40593 CCGGGTCGGTCGGTCCGGGGTCGGTCGGGCCCGGATCGGTGGGGCCCGGGTCCGTCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3437168-3439045	Sequence	SFUL_3022 - RNA polymerase, sigma-24 subunit, ECF subfamily (Protein is coded in complementary strand; from 3439045 to 3437168)