Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3428687
End position: 3428713
Length: 27

DNA sequence
>NC_021177, from 3428687 to 3428713 (27 bp); Streptomyces fulvissimus DSM 40593 TGTTCTCGCTGTTCTCGCTGTTCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3428164-3428718	Sequence	SFUL_3014 - Putative integral membrane protein (Protein is coded in complementary strand; from 3428718 to 3428164)