Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3402823
End position: 3402846
Length: 24

DNA sequence
>NC_021177, from 3402823 to 3402846 (24 bp); Streptomyces fulvissimus DSM 40593 CTCCAGGTCCAGCGCCAGCTCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3402557-3403561	Sequence	SFUL_2991 - Delta-aminolevulinic acid dehydratase (Protein is coded in complementary strand; from 3403561 to 3402557)