Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3348095
End position: 3348118
Length: 24

DNA sequence
>NC_021177, from 3348095 to 3348118 (24 bp); Streptomyces fulvissimus DSM 40593 GCCGGGGGCGGGGCCGGGGTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3346638-3352490	Sequence	SFUL_2944 - Amino acid adenylation domain protein (Protein is coded in complementary strand; from 3352490 to 3346638)