Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3328247
End position: 3328270
Length: 24

DNA sequence
>NC_021177, from 3328247 to 3328270 (24 bp); Streptomyces fulvissimus DSM 40593 TGGGGTGGTGGGGAGGTGGGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3328029-3329051	Sequence	SFUL_2928 - hypothetical protein (Protein is coded in complementary strand; from 3329051 to 3328029)