Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3324844
End position: 3324867
Length: 24

DNA sequence
>NC_021177, from 3324844 to 3324867 (24 bp); Streptomyces fulvissimus DSM 40593 CCGCCGCGGCCGCCGCAGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3324733-3326208	Sequence	SFUL_2925 - FacC-like extracellular signaling protein Precursor