Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3320334
End position: 3320357
Length: 24

DNA sequence
>NC_021177, from 3320334 to 3320357 (24 bp); Streptomyces fulvissimus DSM 40593 CCGTGGCCGTAGCCGTAGCCGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3320274-3322148	Sequence	SFUL_2921 - Cell wall surface anchor family protein (Protein is coded in complementary strand; from 3322148 to 3320274)