Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 331010
End position: 331045
Length: 36

DNA sequence
>NC_021177, from 331010 to 331045 (36 bp); Streptomyces fulvissimus DSM 40593 GCCCGGGTCTTCGTCCCGGTCTTCGCCGGGGCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 330860-331561	Sequence	SFUL_309 - VanZ family protein (Protein is coded in complementary strand; from 331561 to 330860)