Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3287427
End position: 3287462
Length: 36

DNA sequence
>NC_021177, from 3287427 to 3287462 (36 bp); Streptomyces fulvissimus DSM 40593 GTTCCGTGACGCGTTCCGTGACGCGTTCCGTGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3286790-3289684	Sequence	SFUL_2896 - Penicillin acylase (Protein is coded in complementary strand; from 3289684 to 3286790)