Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3280447
End position: 3280470
Length: 24

DNA sequence
>NC_021177, from 3280447 to 3280470 (24 bp); Streptomyces fulvissimus DSM 40593 GCAGCAGCAGCGCCAGCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3279027-3280511	Sequence	SFUL_2889 - secreted penicillin-binding protein (Protein is coded in complementary strand; from 3280511 to 3279027)