Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3258635
End position: 3258670
Length: 36

DNA sequence
>NC_021177, from 3258635 to 3258670 (36 bp); Streptomyces fulvissimus DSM 40593 GGCTCGGCGGGCTCGGCAGACTCGGCGGGCTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3256355-3258970	Sequence	SFUL_2871 - hypothetical protein (Protein is coded in complementary strand; from 3258970 to 3256355)