Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3253669
End position: 3253704
Length: 36

DNA sequence
>NC_021177, from 3253669 to 3253704 (36 bp); Streptomyces fulvissimus DSM 40593 CCGAGGGAGCCGAGGGAGCCGAGGGAGCCGAGGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3253155-3254114	Sequence	SFUL_2869 - hypothetical protein (Protein is coded in complementary strand; from 3254114 to 3253155)