Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3244338
End position: 3244379
Length: 42

DNA sequence
>NC_021177, from 3244338 to 3244379 (42 bp); Streptomyces fulvissimus DSM 40593 TCCGTCTCCGTCTCCGTCTCCGTCTCCGTCTCCGTCTCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3244026-3245249	Sequence	SFUL_2861 - AMP-dependent synthetase and ligase (Protein is coded in complementary strand; from 3245249 to 3244026)