Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3192767
End position: 3192790
Length: 24

DNA sequence
>NC_021177, from 3192767 to 3192790 (24 bp); Streptomyces fulvissimus DSM 40593 TGGAGGTGGCGGTGGACGCGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3190672-3192894	Sequence	SFUL_2814 - Putative transmembrane transport protein (Protein is coded in complementary strand; from 3192894 to 3190672)