Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3176614
End position: 3176637
Length: 24

DNA sequence
>NC_021177, from 3176614 to 3176637 (24 bp); Streptomyces fulvissimus DSM 40593 GCGGCCGAGGCCGCGGCGGCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3176480-3177001	Sequence	SFUL_2796 - YbaK/prolyl-tRNA synthetase associated region